Uckl1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GTAAATGCCTAGGATACACC and CTACCCACCACAGTCCACAT, which resulted in a 1225 bp deletion beginning at Chromosome 2 position 181,574,071 bp and ending after 181,575,295 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001277585 and ENSMUSE00001268540 (exons 2 and 5) and 684 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 2 amino acids later. (J:188991)