Rufy1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTAGGAAGGACTTCAGAGG and TGAGTGTAAGTCATGAGAAT, which resulted in a 208 bp deletion beginning at Chromosome 11 position 50,420,319 bp and ending after 50,420,526 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001231506 (exon 3) and 90 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 165 and early truncation 23 amino acids later. (J:188991)