Kctd5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCTTCACTCTCCCCAGC and TCACTAGACATACTTACGGA, which resulted in a 583 bp deletion beginning at Chromosome 17 position 24,058,991 bp and ending after 24,059,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262470 (exon 3) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 30 amino acids later. (J:188991)