This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAAAGTAAAATAAGACGA and GCAGGACATGACTAATACGG, which resulted in a 900 bp deletion beginning at Chromosome 14 position 32,863,282 bp and ending after 32,864,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000367509 (exon 2) and 501 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a loss of 133 amino acid sequence but remain in frame. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count