Rrbp1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCCATCAGTCACAGTCAG and AGGCGGATGGAGAAGTACAG, which resulted in a 2404 bp deletion beginning at Chromosome 2 position 143,988,095 bp and ending after 143,990,498 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000521125 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele. There is an 11 bp insertion at the deletion site (TTAGTGCTTAG). (J:188991)