This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTGTTCTATGCTATATG and CTTGCATTGCATCATCCCAA, which resulted in a 446 bp deletion beginning at Chromosome 19 position 23,378,605 bp and ending after 23,379,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349008 (exon 3) and 174 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 13 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count