Stac^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTATGGGTCCCCTGAACCT and CCTAGACCCCATGTATACCT, which resulted in a 447 bp deletion beginning at Chromosome 9 position 111,634,731 bp and ending after 111,635,177 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000220207 (exon 2) and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 14 amino acids later. (J:188991)