This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCACACATAGCTTCTCAA and GCAGGTCCAGTGCCTTGCCA, which resulted in a 441 bp deletion beginning at Chromosome 2 position 26,926,633 bp and ending after 26,927,073 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000232711 (exon 2) and 254 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 6 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count