This allele from project TCPR1260 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TAAAAGAGCCATCTACGGGG and GTGTAAAACAGTCAATCGAG targeting the 5' side and CTTCGATCTGAAGAGTCGGG and GCACATCACTAGATAGCATG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion on Chr8: 77413906 to 77413910, a 351-bp deletion on Chr8: 77413460 to 77413810, and a 3-bp deletion Chr8: 77413310 to 77413312 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count