Zfp423^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCATGTGTGCTTCCTAG and GCAGCTGGCCAACTGCTGCA, which resulted in a 3279 bp deletion beginning at Chromosome 8 position 87,780,106 bp and ending after 87,783,384 bp (GRCm38/mm10). This mutation deletes all but the first 29 bp of ENSMUSE00001238707 (exon 4) and 93 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 14 amino acids later. (J:188991)