Slc25a48^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACATGGCATGATAGGAGA and TTTGAAGGTGGCTTTGACAG, which resulted in a 1016 bp deletion beginning at Chromosome 13 position 56,450,617 bp and ending after 56,451,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000381058 (exon 4) and 757 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 4 amino acids later. (J:188991)