This allele from project TCPR1240 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAAGTCAAGTATAGCTGATA and TGAATTCAATCAGATTGGTG targeting the 5' side and ACTAGTAGTGCCGGAGAGAT targeting the 3' side of a critical region. This resulted in a 341-bp del ChrX:105992332 to 105992672 (GRCm38). (J:265051)