This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATTGCACTCATGAGAGT and GTTAAGGTGAGCGCGTCCCG, which resulted in a 788 bp deletion beginning at Chromosome 7 position 19,473,755 bp and ending after 19,474,542 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001376585 (exon 3) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 36 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count