Klc3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCAATGTCCCTACTAGCCA and GAAAGTCAAGTGTCAGGCCG, which resulted in a 265 bp deletion beginning at Chromosome 7 position 19,397,263 bp and ending after 19,397,527 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000233286 (exon 4) and 195 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 163 and early truncation 27 amino acids later. (J:188991)