Ccdc107^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATGTGAAACTCTCCAGT and CGGTAGCCTCAGAAACACAA, which resulted in a 1098 bp deletion beginning at Chromosome 4 position 43,494,976 bp and ending after 43,496,073 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001230953, ENSMUSE00000179397, ENSMUSE00000179398, and ENSMUSE00000179395 (exons 3-6) and 608 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 56 amino acids later. (J:188991)