Arpc1a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGGCATGGGGTAACTGT and TCATGCACATACGAGTTGAG, which resulted in a 444 bp deletion beginning at Chromosome 5 position 145,095,963 bp and ending after 145,096,406 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283146 (exon 4) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 1 amino acid later. (J:188991)