This allele from project TCPR1235 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATCCTCTAATTGGACACCTT and CTGACTACCTATGAGTGCAA targeting the 5' side and GCACTCTGTCTTAAGCGGAA and GTAATGGTCACCTGTTTGGT targeting the 3' side of a critical region. This resulted in a 1141-bp del Chr12:78895781 to 78896921 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count