This allele from project TCPR1236 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGTGGTGCTTACATTCTTAG and TCTATCATTACCATAACTGT targeting the 5' side and GTGCCATTCCTCACACGGTC and GAAGCGGCAAGGGCTGCTTA targeting the 3' side of a critical region. This resulted in a mutation in Chr9: 57919179_insT; 1417-bp del Chr9: 57919248 to 57920718 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count