Ankrd24^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGCACACCCAGAGGTGCGA and ATGGAAGGACCGTCCCTGGG, which resulted in a 339 bp deletion beginning at Chromosome 10 position 81,634,842 bp and ending after 81,635,180 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001232215 and ENSMUSE00001292617 (exons 3 and 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. (J:188991)