Rell1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTTCAGATTGATTCCCT and ACTCCAAATTTATCTGACAT, which resulted in a 323 bp deletion beginning at Chromosome 5 position 63,930,418 bp and ending after 63,930,740 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221914 (exon 4) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 130 and early truncation 11 amino acids later. (J:188991)