This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTTATCAGAAAAGAATA and CGAGCCGCGAAGCGGCCGCG, which resulted in a 2165 bp deletion beginning at Chromosome 6 position 58,904,976 bp and ending after 58,907,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000459071 (exon 1) and 321 bp of flanking intronic sequence including the Kozak sequence and start site and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count