Abhd4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAAAATGTCTGTGCTCTC and TGATCGCTAGGGAAGCCATG, which resulted in a 3008 bp deletion beginning at Chromosome 14 position 54,262,600 bp and ending after 54,265,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324218, ENSMUSE00001373598, ENSMUSE00000324196 (exons 3-5) and 2368 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 8 amino acids later. (J:188991)