Pole3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATACAATGTGCTTTTGCAA and CCACTCTGACAGCTTCTGAA, which resulted in a 1834 bp deletion beginning at Chromosome 4 position 62,522,627 bp and ending after 62,524,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001250923 and ENSMUSE00001277871 (exons 3 and 4) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 1 amino acid later. In addition, there is a 2 bp (CT) insertion at the deletion site. (J:188991)