Aco1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGAAAAGCAGGTGCCCTG and CCCCGCCTCACCAGTGACAG, which resulted in a 471 bp deletion beginning at Chromosome 4 position 40,164,567 bp and ending after 40,165,037 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001252959 (exon 3) and 302 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 14 amino acids later. (J:188991)