This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTTTCCTTCAGACCCA and GCTTTAATAGCTTAAAGTAT, which resulted in a 1100 bp deletion beginning at Chromosome 15 position 4,904,805 bp and ending after 4,905,904 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124014 and ENSMUSE00000124016 (exons 5 and 6) and 846 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 5 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count