Syt8^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACTACTGTAGCTTCCAA and CTAGGCCTTTCCCTGAAAAA, which resulted in a 1829 bp deletion beginning at Chromosome 7 position 142,438,739 bp and ending after 142,440,567 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001253691 through ENSMUSE00000668076 (exons 4-9) and 834 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 44 amino acids later. (J:188991)