Adam5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCTACTAGAAGATGACAC and CTTCAGACTGAAGAAAACTC, which resulted in a 583 bp deletion beginning at Chromosome 8 position 24,813,126 bp and ending after 24,813,708 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349613 (exon 6) and 405 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 12 amino acids later. (J:188991)