Tex28^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAAAGTCTCCAAAGCACCT and GCTCTGAGTAAAGGTACAGA, which resulted in a 510 bp deletion beginning at Chromosome X position 74,151,956 bp and ending after 74,152,465 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000495133 (exon 4) and 374 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 246 and early truncation 1 amino acids later. (J:188991)