Spats2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCATATTGTGAACTGCAC and GCCGCAGCGCAGTCTCCGGA, which resulted in a 396 bp deletion beginning at Chromosome 15 position 99,173,334 bp and ending after 99,173,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000296931 (exon 4) and 287 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 10 amino acids later. (J:188991)