This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAGGGGAAAACTAATCGAG and CCTTACGTCATTTCACAACT, which resulted in a 544 bp deletion beginning at Chromosome X position 9,913,615 bp and ending after 9,914,158 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000656653 (exon 3) and 428 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 110 and early truncation 1 amino acid later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count