Thoc7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCCTTAATAAAGTTCCACC and GGTATATCTGCCTGTCCTAG, which resulted in a 569 bp deletion beginning at Chromosome 14 position 13,954,335 bp and ending after 13,954,903 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517611 (exon 2) and 451 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. (J:188991)