This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCTTTTCACCTGTCAAGA and GGACAATGCTGAATCCATGA, which resulted in a 571 bp deletion beginning at Chromosome 7 position 133,601,825 bp and ending after 133,602,395 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000205104 (exon 1) and 380 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count