This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAAGTCCCTGATAGGCCA and ATGAGACTAGGGCCCCCAGG, which resulted in a 2945 bp deletion beginning at Chromosome 19 position 42,031,812 bp and ending after 42,034,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000148508 and ENSMUSE00000384994 (exons 2 and 3) and 1664 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 61 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count