This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACCAATGAGAATTCACCAG and AATGTACACAGACAGGAGCG, which resulted in a 336 bp deletion beginning at Chromosome 9 position 42,449,776 bp and ending after 42,450,111 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000403463 (exon 3) and 196 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 2 amino acids later. There is a single (G) bp insertion at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count