Ier5l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGATACCCCCATATCCGCA and CGGAGGCTCCTAGTCCCACG, which resulted in a 3057 bp deletion beginning at Chromosome 2 position 30,471,400 bp and ending after 30,474,456 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000462138 (exon 1) and 374 bp of flanking intronic sequence including the transcription start site and is predicted to result in a null allele. (J:188991)