This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 2 guide sequences, GCTCTCATTTCATGTACGT, GCAATCGGAAGGTCACTGGA, which resulted in a 62 bp deletion beginning at approximately Chromosome 15 position 85,844,505 bp, ACATGAAA, and ending after 85,844,566 bp, GGTCACT (GRCm38.p6/mm10). This mutation deletes much of ENSMUSE00001278296 (exon 7). (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count