This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 4 guide sequences, GTTGACCAGTTTGTTGCG, GTACTTCTCCTGTAATGAA, GCACACATGGGATCCTT, and GTTCTTGGTGAGCTGGGCAC, which resulted in a 60 bp deletion beginning at approximately Chromosome 1 position 195176543 bp, CTTGGG, and ending after 195176602 bp, GCTGGG (GRCm38.p4/mm10). This mutation deletes most of exon 1 and some of the downstream intron. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count