Polr2l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGTCTGTAGGCCTTGCTA and CTATCCACACGAATACCCAG, which resulted in a 1828 bp deletion beginning at Chromosome 7 position 141,471,653 bp and ending after 141,473,480 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000668186 (exon 2) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and immediate truncation probably due to run on into the intron. (J:188991)