Cmtr1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGACCCACACTAGACAT and GGTGGGGCACAAGTTAGCAC, which resulted in a 344 bp deletion beginning at Chromosome 17 position 29,674,049 bp and ending after 29,674,392 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374637 (exon 3) and 192 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 12 amino acids later. (J:188991)