Sfswap^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTAAGAACTGCTAGCAAGG and ATTATCTTGACAGTACCCAG, which resulted in a 554 bp deletion beginning at Chromosome 5 position 129,503,713 bp and ending after 129,504,266 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000188909 (exon 2) and 384 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 7 amino acids later. (J:188991)