This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCGTGAGCCAACTACATGG and GTAGCCTCCCCAAAGCCCAA, which resulted in a 342 bp deletion beginning at Chromosome 4 position 24,792,530 bp and ending after 24,792,871 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221273 (exon 3) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 15 amino acids later. There is an additional 11 bp deletion (CTGGACAGAAC) 40 bp after the large deletion. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count