Faxc^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGAGGGCAACAATCCCACA and GTAAACCTAAAAGTACCACC, which resulted in a 490 bp deletion beginning at Chromosome 4 position 21,936,545 bp and ending after 21,937,034 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283152 (exon 2) and 354 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 28 amino acids later. There is a 7 bp insertion [TTTTAAG] at the deletion site. (J:188991)