This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGATCAGTAGAAACAAGACT and AATTGTTTCATTCAGTGTTA, which resulted in a 292 bp deletion beginning at Chromosome 4 position 120,790,326 bp and ending after 120,790,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000412384 (exon 2) and 179 bp of flanking intronic sequence including the start and splice donor and is predicted to cause a null allele unless a downstream ATG is used. In addition, there is a 7 bp insertion [TATCAGT] at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count