Dhx37^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AAAACTGCCGTGGATCTCAA, AGACGAACAGAGTCTCACTA, GCACCAGCTCTCCAGATCAG and ATATTTGTCATGAGTAAGCA, which resulted in a 232 bp deletion beginning at Chromosome 5 position 125,431,557 bp and ending after 125,431,788 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001016994 (exon 2) and 62 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 9 amino acids later. (J:188991)