This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTACAATACAGCTTAGTAT and GGATAGCCTTTTTTTGTATT, which resulted in a 2080 bp deletion beginning at Chromosome 11 position 77,691,456 bp and ending after 77,693,535 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000292192 (exon 2) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 delete 571 amino acids and stop 28 amino acids later. This transcript does not go out of frame but removes >80% of the coding sequence. (J:188991)