Mphosph10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTCCTTATGGTTTTATGG and CTACTTGCCTGGAGATACCC, which resulted in a 1188 bp deletion beginning at Chromosome 7 position 64,389,174 bp and ending after 64,390,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000592989 (exon 2) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 7 amino acids later. (J:188991)