Prr5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCCTCACCAGTACTGT and AGCCCTCCTGGGCTCCCAAG, which resulted in a 481 bp deletion beginning at Chromosome 15 position 84,693,421 bp and ending after 84,693,901 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000622449 and ENSMUSE00000622448 (exons 3 and 4) and 374 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 16 amino acids later. There is also a single bp (A) insertion at the deletion site. (J:188991)