This allele from project TCPR1341 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCCCGGGAATTCTACCCGTC and CGTCTACAAGTCTACCCGTT targeting the 5' side and GGCTGGATTAAAGACGCCAT targeting the 3' side of a critical region. This resulted in a 873-bp deletion of Chrx from 37191426 to 37192298 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count