This allele from project TCPR1136 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) having spacer sequences of GGAACCAGGTCCCCGTCTGT and AGTGCCGACGCGCTCACCTA targeting a critical exon. This resulted in a 457-bp del Chr4:43685599 to 43686055 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count