This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CCCATCCTGTTCATCCGCACCCC, AGGAGAAGATAGTGCTGGGAGGG, CCCTTCTTTCAATCATCCCGGAA, CCCCTGATGCTCCCTGCTAAGCC, which resulted in a Exon Deletion. (J:265051)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count